Tags:

Solexa Sequencing

Solexa Sequencing


Applications

The Illumina Genome Analyzer (also referred to as Solexa) is available for use in many applications, including but not limited to:

  • Whole genome shotgun sequencing for SNP detection
  • ChIP-Seq
  • Small RNA discovery/expression
  • Digital gene expression

As there are many types of applications it is essential that you speak with us regarding the specific goals and technical aspects of your research projects.


Service and Sample Submission


All users are required to fill the Sample Submission Form (coming soon) and email it to us at...


We can sequence up to 8 samples in a run. You can submit any number of samples and use any number of lanes, as we can combine different users' samples in one run.


At the current time, we are not offering library preparation services and will only be able to perform cluster generation and sequencing on samples provided to us.


Cluster Generation and Sequencing-only service:


We can perform sequencing on customer generated libraries, provided they are constructed in accordance with standard Illumina protocols or you have spoken with us about a specific custom library construction scheme. Sample preparation kits can be purchased from Illumina, and protocols are available on Illumina website (www.illumina.com) and on this wiki page. Currently, kits are available for genomic DNA, small RNA and gene expression applications. Please contact us to be sure you are ordering the proper kit for you application and research goals.  


Pre-made library submission:


For each sample, 5ul of 100nM template is required. This is to make sure that we can accurately check the DNA concentration with NanoDrop. If you cannot provide templates at this concentration, then you need to provide minimum 5 ul of 10nM templates. In this case, however, you are responsible to make sure that the quantitation is accurate. Too high or two low template concentration might result in poor cluster generation and poor sequencing data.


The templates must be ~150-200bp including adapter/primer sequence. An agarose gel picture showing template size is required. A260:280 reading needs to be above 1.8.


Data Output and Delivery


A typical sequencing run generates 1-4 million reads per lane, with read length up to 35 bp. Currently, the standard outputs we generate are sequence files in FASTA and FASTQ formats with base-calling quality scores. We will deliver the files to users  by placing them on our server for retrieval. FASTA/FASTQ files are about 1 GB for each lane.  Files will not be stored permanently, it is the users responsibility to download the files and store them in a secure manner. 


An example of FASTA/FASTQ file is shown below:


FASTQ 

Line 1: Unique ID for a sequencing read

Line 2: Sequences

Line 3: Repeat of the ID (preceded with a + sign)

Line 4: Base calling quality score (Analogous to Phred scores)


@12_10_2007_SequencingRun_3_1_119_647

TTTGAATATATTGAGAAAATATGACCATTTTT

+12_10_2007_SequencingRun_3_1_119_647

40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 27 40 40 4 27 40


FASTA

Line 1: Unique ID for a sequencing read

Line 2: Sequences

No quality score info included in this format


>12_10_2007_SequencingRun_1_1_120_705

GTTTTGAATTTCACACGCTTTCAGAATTTAAT


Data Storage


Due to the huge size of image files, they can only be stored on our servers for one month. If you want to store the image files for longer time, please provide us a hard drive of at least 150GB for one lane, or 1TB for a whole run (8 lanes).


Pricing (subject to change at any time)


Service Internal External
Standard Cluster Generation and Sequencing 36 cycles (per lane) $700 $1400
Paired-end Cluster Generation and Sequencing 36 cycles (per lane) $1400 $2800


Next Generation Sequencing Informatics Pipeline Software

Sequences of primers and adapters used for Solexa library preparations